CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 567
Type of strain Targeted mutant.
Strain name B6;129-Gsctm1Card
Internal Code goosecoid, B6;129-Gsctm1Card
Submitter Yamada Gen
Submitter affiliation or code Department of Developmental Genetics Research, Wakayama Medical University (WMU)
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Max-Planck-Institute(MPI・ドイツ)
Organization code
Developer Gen Yamada
Year introduced 1994
Introduced Generation
Remarks


Gene information

Gene symbol Gsc
Gene name goosecoid
Allele symbol Gsctm1Card
Allele name targeted mutation 1, Center for Animal Resources and Development, Kumamoto University
MGI MGI:95841,
Chromosome 12 (52.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM OMIM ID: 138890 Human Gene Symbol: GSC,

PCR Primer 1
Gsc-S46 GTGCCGAGGGAGGATGACTGAC
Gsc-N2 TAGCCTCTCCACCCAAGCGGC


References

Author Gen Yamada, Ahmed Mansouri, Miguel Torres, Edward T. Stuart, Martin Blum, M. Schultz, Eddy M. De Robertis and Peter Gruss
Title Targeted mutation of the murine goosecoid gene results in craniofacial defects and neonatal death
Journal Development
Volume 121
Page 2917-2922
Year 1995
PMID 7555718


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.