CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 556
Type of strain Targeted mutant.
Strain name ICR.129-Il6sttm1
Internal Code gp130tm, ICR.129-Il6sttm1
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Osaka University
Organization code Unknown
Developer Kanji Yoshida
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Il6st (synonim:gp130)
Gene name interleukin 6 signal transducer
Allele symbol Il6sttm1
Allele name targeted mutation 1
MGI
Chromosome 13 (67.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM OMIM ID: 600694 Human Gene Symbol: IL6ST,

PCR Primer 1
p-370 CCCCAACCTTAACATTATGGAGGTAG
P-neo CCGACTGCATCTGCGTGTTCGAATT


References

Author KANJI YOSHIDA, TETSUYA TAGA, MIKIYOSHI SAITO, SACHIKO SUEMATSU, ATSUSHI KUMANOGOH, TAKASHI TANAKA, HIROSHI FUJIWARA, MORITOSHI HIRATA, TAMOTSU YAMAGAMI, TATSUTOSHI NAKAHATA, TOMOKO HIRABAYASHI, YOSHIHIRO YONEDA, KAZUHIKO TANAKA, WEI-ZHONG WANG, CHISATO MO
Title Targeted disruption of gp130, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders (myocardial development/hematopoiesis)
Journal Medical Science
Volume 93
Page 407-411
Year 1996
PMID 12093905


Disease , Applicable field information

Disease name, Applicable field Neurobiology, Development






Copyright @ 2021 Kumamoto University. All rights reserved.