CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 553
Type of strain Targeted mutant.
Strain name B6.CB-Ahctf1tm1(EGFP)
Internal Code , B6.CB-Ahctf1tm1(EGFP)
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Kumamoto University
Organization code
Developer Keisuke Okita
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ahctf1(old symbol:Elys)
Gene name AT hook containing transciption factor 1
Allele symbol Ahctf1tm1(EGFP)
Allele name targeted mutation 1
MGI
Chromosome 1 (102) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM OMIM ID: 610853 Human Gene Symbol: AHCTF1,

PCR Primer 1
mYs321F GGCAGTATGCAAGACTTGAC
EGFP SeqF GAACTTGTGGCCGTTTACGT


References

Author Keisuke Okita, Hiroshi Kiyonari, Ikuo Nobuhisa, Naoki Kimura, Shinichi Aizawa and Tetsuya Taga
Title Targeted disruption of the mouse ELYS gene results in embryonic death at peri-implantation development
Journal Genes to Cells
Volume 9
Page 1083-1091
Year 2004
PMID 15507119


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.