CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 508
Type of strain Targeted mutant.
Strain name B6;129S4-Frap1tm2
Internal Code mTOR conditional knockout mouse, B6;129S4-Frap1tm2
Submitter Shinya Yamanaka
Submitter affiliation or code Center for iPS Cell Research and Application (CiRA), Kyoto University
Stock Type
Material Transfer Conditions Others
(1) Recipient and Recipient scientist shall receive the prior written approval from Provider, if Recipient scientist uses the material with anyone else outside of the Recipient scientist's laboratory to carry out the Research. (2) The material shall be used only by Recipient scientist and others working under Recipient scientist's direct supervision at Recipient scientist's laboratory, and shall not be used by, as well as shall not be distributed and assigned to anyone else either at the Recipient organization or outside the organization. (3) At the time of publication of the result from the Research using the material, whether in print or in electronic form, Recipient scientist shall provide a copy of each publication to Provider. (4) Recipient and Recipient scientist acknowledge that this Agreement is not the agreement to license the intellectual property rights relating the material owned by Provider to Recipient and Recipient scientist. Recipient and Recipient scientist also acknowledge that no express or implied licenses or other rights are provided to Recipient and Recipient scientist from Provider to use the material, or any related patents of Provider for commercial purposes. (5) Recipient scientist shall cite the paper specified below in any publication of the result from the Research. Murakami, M. et al. mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol Cell Biol. 2004 Aug;24(15):6710-8.
Production method in-house breeding
Origin (In-house) Organization Center for iPS Cell Research and Application (CiRA), Kyoto University
Organization code
Developer Shinya Yamanaka
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Frap1
Gene name FK506 binding protein 12-rapamycin associated protein 1
Allele symbol Frap1tm2
Allele name targeted mutation 2
MGI
Chromosome 4 (71.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM OMIM ID: 601231 Human Gene Symbol: FRAP1,

PCR Primer 1
β geo-screening 1 AATGGGCTGACCGCTTCCTCGTGCTT
c-con TOR tail L33303 TGGAGATCCTTGGCACACCTGCTCAT


References

Author Mirei Murakami, Tomoko Ichisaka, Mitsuyo Maeda, Noriko Oshiro, Kenta Hara, Frank Edenhofer, Hiroshi Kiyama, Kazuyoshi Yonezawa, and Shinya Yamanaka
Title mTOR Is Essential for Growth and Proliferation in Early Mouse Embryos and Embryonic Stem Cells
Journal MOLECULAR AND CELLULAR BIOLOGY
Volume 24
Page 6710-6718
Year 2004
PMID 15254238


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.