CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 501
Type of strain Targeted mutant.
Strain name B6;129-Sall4tm5
Internal Code N-Sall4 #14
Submitter Nishinakamura Ryuichi
Submitter affiliation or code Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Univ. of Tokyo. Inst. of Med. Sci. Div. of Stem Cell regulation
Organization code
Developer Masayo Yumoto
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Sall4
Gene name sal-like4 (Drosophila)
Allele symbol
Allele name
MGI MGI:2139360,
Chromosome 2 (99.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
N-Sall4 genome check (N-Sall4 F, N-Sall4 R, N-Sall4 X CAG-cre R); mixture of 25 micro M each CCTTCACCTTGAAGCCTGAC, GGGACAGGGAGTGCATAGTG, CAGCCTGGTCTACAGTGCAA
 


References

Author
Title
Journal
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.