CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 466
Type of strain Targeted mutant.
Strain name B6;129-Dullardtm1Imeg
Internal Code -
Submitter Nishinakamura Ryuichi
Submitter affiliation or code Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Division of Intergrative Cell Biology, IMEG, Kumamoto University
Organization code
Developer Ryuichi Nishinakamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Dullard
Gene name Dullard homolog (Xenopus laevis)
Allele symbol
Allele name
MGI MGI:1914431,
Chromosome 11 (B4 band) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Du15783s, Du16012as ; mixture of 25 micro M each GTTCTTGGGACACCGTCTGT, AGTCCTGCCTCTTCACCAGA
neo β c KO, Du-2 ; mixture of 25 micro M each "GCGTTGGCTACCCGTGATAT, TTACAGGTATGGGGGATTGG"


References

Author
Title
Journal
Volume
Page
Year
PMID
Author Tanaka SS, Nakane A, Yamaguchi YL, Terebayashi T, Abe T, Nakao K, Asashima M, Steiner KA, Tam PP, and Nishinakamura R
Title Dullard/Ctdnep1 modulates WNT signaling activity for the formation of primordial germ cells in the mouse embryo.
Journal PLoS One
Volume 8(3)
Page e57428
Year 2013
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.