CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3075
Type of strain Targeted mutant.
Strain name C57BL/6NJcl-Pon1em1
Internal Code Pon1 Knockout Hetero
Submitter Miura Kyoko
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced 2018 / 11
Introduced Generation F0
Remarks


Gene information

Gene symbol Pon1
Gene name Paraoxonase1
Allele symbol Pon1em1
Allele name Paraoxonase1; endonuclease-mediated mutation 1,
MGI MGI:103295,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Pon1_KO_primer_F TGGCTAAATTGGAGCTGTGG
Pon1_KO_primer_R AGTGTTCACCCAGAACAAGGAG
PCR Primer 2
Pon1_Wild_primer_F AGAGCTTTGCTAATGCCTCCAGT
Pon1_Wild_primer_R ATGCCCTGTGTTTGGAATGCTCT


Disease , Applicable field information

Disease name, Applicable field Metabolism, Pharmacology, Aging






Copyright @ 2021 Kumamoto University. All rights reserved.