CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 3002
Type of strain Targeted mutant.
Strain name C57BL/6-Ffar3tm1Gdds Hcar2em1
Internal Code GPR41/109A doubleKO
Submitter Kimura Ikuo
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology
Organization code
Developer Ikuo Kimura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ffar3
Gene name Free fatty acid receptor 3
Allele symbol Ffar2tm1
Allele name Free fatty acid receptor 2, targeted mutation 1
MGI MGI:2441731,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM
Gene symbol Hcar2
Gene name hydroxycarboxylic acid receptor 2
Allele symbol Hcar2em1
Allele name hydroxycarboxylic acid receptor 2; endonuclease-mediated mutation 1,
MGI MGI:1933383,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
out41-s GCAGCAGAGTGCCAGTTGTCC
out41-as, 3primer-neo(primer3) GCGTGTGAGTGGTCCTTCCATCC, GGCTATTCGGCTATGACTGG
PCR Primer 2
Gpr109a-PCR-F2 AATTTCACACGAACTCTTACTGCTC
Gpr109a-PCR-R1 GAGAACAATCAAATCTTTTGCATCT


Disease , Applicable field information

Disease name, Applicable field Unknown


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.