CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2989
Type of strain Targeted mutant.
Strain name C57BL/6J-Six2em1
Internal Code Six2 (f102)
Submitter Takahashi Masanori
Submitter affiliation or code Center for Molecular Medicine, Jichi Medical University
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization Jichi Medical University
Organization code
Developer Masanori Takahashi
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Six2
Gene name sine oculis-related homeobox 2
Allele symbol Six2em1
Allele name
MGI MGI:102778,
Chromosome 17 (55.72) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Six2-F primer (25mer) TCCTCCTCCTCTGCTCTTTGGGCGT
Six2-Mut-R primer (25mer) CTCCCAGTCTTTCGGCAGATCCCAG


Disease , Applicable field information

Disease name, Applicable field Dentistry, Urology, Development






Copyright @ 2021 Kumamoto University. All rights reserved.