CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2988
Type of strain Targeted mutant.
Strain name C57BL/6N-Fbxl20tm1
Internal Code Scrapper-flox mouse
Submitter Yao Ikuko
Submitter affiliation or code Kwansei Gakuin University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Kwansei Gakuin Univ.
Organization code
Developer Ikuko Yao
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Fbxl20
Gene name F-box and leucine-rich repeat protein 20
Allele symbol Fbxl20tm1
Allele name F-box and leucine-rich repeat protein 20; targeted mutation 1,
MGI MGI:1919444,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Scrapper-loxF1 GACGGTTGACATGGTGACAG
Scrapper-loxR1 GTTCTCAAATACAGCGGTGG


Disease , Applicable field information

Disease name, Applicable field Metabolism, Neurobiology






Copyright @ 2021 Kumamoto University. All rights reserved.