CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2974
Type of strain Targeted mutant.
Strain name C57BL/6J-Pdpnem1Osb
Internal Code Pdpn KO
Submitter Yamasaki Sho
Submitter affiliation or code Department of Molecular Immunology, Research Institute for Microbial Diseases, Osaka University
Stock Type
Material Transfer Conditions No condition
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Pdpn
Gene name Podoplanin
Allele symbol Pdpnem1Osb
Allele name podoplanin; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:103098,
Chromosome 4 (77.29) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
pdpn forward primer GCCTGTGGCTTCGAAGTTTTT
pdpn reverse primer AACAAGTGCTGGTTGCCAATCAT


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.