CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2879
Type of strain Targeted mutant.
Strain name C57BL/6-Kctd19em1
Internal Code KCTD19-Line#12
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Kctd19
Gene name z
Allele symbol Kctd19em1>
Allele name potassium channel tetramerisation domain containing 19; endonuclease-mediated mutation 1,
MGI MGI:3045294,
Chromosome 8 (53.04) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
KCTD19-F4 GGACTTCCAGGAATGCAGTGACAGG
KCTD19-R3 TGGCTTAAAGGTTGGCTCTGGACCC
PCR Primer 2
KCTD19-F3 TAAAATACCGTCCCAAAGCAAGTCAC
KCTD19-R1 TTTCCCATGCCACCTGTGCCTTTCC


References

Author Horisawa-Takada Y, Kodera C, Takemoto K, Sakashita A, Horisawa K, Maeda R, Usuki S, Fujimura S, Tani N, Matsuura K, Shimada R, Akiyama T, Suzuki A, Niwa H, Tachibana M, Ohba T, Katabuchi H, Namekawa S, Araki K, Ishiguro K
Title Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis
Journal Nature Communications
Volume In press
Page
Year 2021
PMID


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.