CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2850
Type of strain Targeted mutant.
Strain name C57BL/6-Taf7l2em1
Internal Code 4933416C03Rik/TAF7L2
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Taf7l2
Gene name Taf7l2
Allele symbol 4933416C03Rikem1
Allele name Taf7l2; endonuclease-mediated mutation 1,
MGI MGI:6274337,
Chromosome 10 (64.48) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
4933416C03Rik-F1 GAGGAGGTGTAGAGGCAAACAGAGG
4933416C03Rik-R1 CAAGATCAATTGGGACCCTTTAAGC


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.