CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2845
Type of strain Targeted mutant.
Strain name STOCK-Ehbp1l1tm1
Internal Code Ehbp1l1 tm1
Submitter - -
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Osaka University
Organization code
Developer Akihiro Harada
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Ehbp1l1
Gene name EH domain binding protein 1-like 1
Allele symbol Ehbp1l1tm1
Allele name EH domain binding protein 1-like 1, targeted mutation 1,
MGI MGI:3612340,
Chromosome 19 (4.34) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
EHBP1L1-F GACAAAGAAAAGAGCTCCAGAGACC
EHBP1L1-R CCTTGACAGTCCAATACAAGACCTG


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.