CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2827
Type of strain Targeted mutant.
Strain name C57BL/6-Mpsttm1
Internal Code C57BL/6J-Mercaptopyruvate sulfurtranferase (targeted mutation 1)
Submitter ISHII ISAO
Submitter affiliation or code Showa Pharmaceutical University
Stock Type
Material Transfer Conditions Others
Collaboration with Prof. Isao Ishii at Showa Pharmaceutical University. Concession to the third person is prohibited.
Production method in-house breeding
Origin (In-house) Organization Showa Pharmaceutical University
Organization code
Developer Isao Ishii
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Mpst
Gene name Mercaptopyruvate sulfurtransferase
Allele symbol Mpstem1
Allele name Mercaptopyruvate sulfurtransferase, endonuclease-mediated mutation 1,
MGI MGI:2179733,
Chromosome 15 (37.47) (E2|15) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Mpst-3 GCATATAAGGCCAGCACACG
Mpst-7 AGCTGGGCTACATCTTAGAGA


References

Author Akahoshi, N., Minakawa, T., Miyashita, M., Sugiyama, U., Saito, C., Takemoto, R., Honda, A., Kamichatani, W., Kamata, S., Anan, Y., Ishii, I.
Title Increased Urinary 3-Mercaptolactate Excretion and Enhanced Passive Systemic Anaphylaxis in Mice Lacking Mercaptopyruvate Sulfurtransferase, a Model of Mercaptolactate-Cysteine Disulfiduria.
Journal Int J Mol Sci
Volume 21
Page 818; doi:10.3390/ijms21030818
Year 2020 Jan 27
PMID


Disease , Applicable field information

Disease name, Applicable field Behavior, Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.