CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2782
Type of strain Targeted mutant.
Strain name C57BL/6-Nfatc1tm2
Internal Code Nfatc1 variant 3 exon1-specific knockout mice61a
Submitter Mimura Toshihide
Submitter affiliation or code Department of Rheumatology and Applied Immunology,Faculty of Medicine, Saitama Medical University
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced 2015 / 7
Introduced Generation
Remarks


Gene information

Gene symbol Nfatc1
Gene name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Allele symbol Nfatc1tm2
Allele name nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1; targeted mutation 1,
MGI MGI:102469,
Chromosome 18 (53.66) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
target_S TCCAGTCCCTTCCAAGTTTCCACTC
target_R TCTGGGCTGCGCCGGGGAAACAC


Disease , Applicable field information

Disease name, Applicable field Immunology, Osteosis






Copyright @ 2021 Kumamoto University. All rights reserved.