CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2766
Type of strain Targeted mutant.
Strain name C57BL/6-Sordem2
Internal Code Sord #24
Submitter Kojima Masayasu
Submitter affiliation or code Kurume University Institute of Life Science
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Sord
Gene name Sorbitol dehydrogenase
Allele symbol Sordem2
Allele name Sorbitol dehydrogenase, endonuclease-mediated mutation 1,
MGI MGI:98266,
Chromosome 2 (60.59) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
mSORD13357-: GCAGTCTCTGGCCAGTTTTC
mSORD -30158 TTGCCTGTGAGTGACTCTGG
mSORD -14158 TCAGTGCAAGCACTCACACA
mSORD 29022- GGAAACATGAATGGGGTGAC


Disease , Applicable field information

Disease name, Applicable field Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.