CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2738
Type of strain Targeted mutant.
Strain name C57BL/6-Gm4969em1
Internal Code Gm4969 (del6-14) crispr-ssODN#7
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gm4969(Meiosin)
Gene name predicted gene 4969
Allele symbol Gm4969(StIP1) em1
Allele name predicted gene 4969, endonuclease-mediated mutation 1,
MGI MGI:3647482,
Chromosome 7 (9.46) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Gm4969-29909R gggTGTCAAAGTATAGAAGCAAAATGC
Gm4969-22787F AAGAAGAAGTTTACCCGAGTGTCAG
Gm4969-29605F CCAGAGAGGAAATGTATTTACTGATCC


References

Author Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa
Title MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells
Journal Developmental Cell
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.