CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2672
Type of strain Targeted mutant.
Strain name BALB/cbyJJcl-Vps13atm1Asan
Internal Code BALB/c-ChAc
Submitter Sano Akira
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Kagoshima University Graduate School of Medical and Dental Sciences
Organization code
Developer Akira Sano
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Vps13a
Gene name vacuolar protein sorting 13A
Allele symbol Vps13atm1Asan
Allele name vacuolar protein sorting 13A, targeted mutation 1, Akira Sano
MGI MGI:2444304,
Chromosome 19 (11.71) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
wild-F ACAATGCCAAGAGAATAGAGTT
Neo-F TTGTCAAGACCGACCTGTCC
intR-S GGGCCCCTAATGAAGAGAAA


References

Author Sakimoto H, Nakamura M, Nagata O, Yokoyama I, Sano A
Title Phenotypic abnormalities in a chorea-acanthocytosis mouse model are modulated by strain background.
Journal
Volume
Page
Year
PMID
Author Tomemori Y, Ichiba M, Kusumoto A, Mizuno E, Sato D, Muroya S, Nakamura M, Kawaguchi H, Yoshida H, Ueno S, Nakao K, Nakamura K, Aiba A, Katsuki M, Sano A.
Title A gene-targeted mouse model for chorea-acanthocytosis.
Journal
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.