CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2640
Type of strain Targeted mutant.
Strain name C57BL/6-Stra8em1(GFP)
Internal Code Stra8-3FH Ex9 (Lx22-T1bp ins)
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Molecular Embryology and Genetics, Kumamoto University
Organization code
Developer Kei-ichiro Ishiguro
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks This allele was generated by ssODN methods, by injecting Crisp-Cas9 into fertilized egg of Stra8-3xFLAG-HA-2A-GFP genetic background.


Gene information

Gene symbol Stra8
Gene name stimulated by retinoic acid gene 8
Allele symbol Stra8em1(GFP)
Allele name stimulated by retinoic acid gene 8, endonuclease-mediated mutation 1,
MGI MGI:107917,
Chromosome 6 (15.20) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
St8-24996F AGGCCCAGCATATGTCTAACATCAG
KI92ES-29564R AGAAGGCTTTTGGAAGCAGCCTTTC


References

Author Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa
Title MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells
Journal Developmental Cell
Volume
Page
Year
PMID


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Development






Copyright @ 2021 Kumamoto University. All rights reserved.