CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2630
Type of strain Targeted mutant.
Strain name C57BL/6-Paqr9tm1
Internal Code Paqr9KO
Submitter Kimura Ikuo
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Department of Applied Biological Science, Graduate School of Agriculture, Tokyo University of Agriculture and Technology
Organization code
Developer Ikuo Kimura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Paqr9
Gene name progestin and adipoQ receptor family member IX
Allele symbol Paqr6tm1
Allele name progestin and adipoQ receptor family member VI, targeted mutation 1
MGI MGI:1922802,
Chromosome 9 (50.15) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
PAQR9F(WT) CAACGTGAGCAAGATCCCTGAG
PAQR9R(common) GCTAGACCTCAGAAGCAGCC
PCR Primer 2
F(neo MS02) TTCGCAGCGCATCGCCTTCTATCG
PAQR9R(common) GCTAGACCTCAGAAGCAGCC


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.