CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2626
Type of strain Targeted mutant.
Strain name C57BL/6- Gm4969 em2
Internal Code StIP1Ex1 KO
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gm4969(StIP1)
Gene name predicted gene 4969
Allele symbol Gm4969 em2
Allele name predicted gene 4969, endonuclease-mediated mutation 2,
MGI MGI:3647482,
Chromosome 7 (9.46) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Gm4969-13926F GTCCTATTTTAGGAACTCTAGGTGC
Gm4969-14285R GAAATGAAGGACTATACGCACCTAC


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.