CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2624
Type of strain Targeted mutant.
Strain name C57BL/6-M1apem1
Internal Code M1ap-Ex1crispr 24del
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol M1ap
Gene name meiosis 1 associated protein
Allele symbol M1apem1
Allele name meiosis 1 associated protein, endonuclease-mediated mutation 1,
MGI MGI:1315200,
Chromosome 6 (35.94) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
M1ap-19439F ACCTGATCCAATTTTATGAAAGCCAGTC
M1ap-19851R CAACTGTGAGTTCTGCTATGGAAATCTC


Disease , Applicable field information

Disease name, Applicable field Cell biology, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.