CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2619
Type of strain Targeted mutant.
Strain name B6D2-Wdr63em1Osb
Internal Code Wdr63 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Wdr63
Gene name WD repeat domain 63
Allele symbol Wdr63em1Osb
Allele name WD repeat domain 63, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:3045269,
Chromosome 3 (71.03) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Wdr63Fw GGGAATTCGATCTAGTCCAGGCCCAAACC
Wdr63Rv GGGGATCCGATGCGATCTAAACCCTCGGG


References

Author Young SA, Miyata H, Satouh Y, Kato H, Nozawa K, Isotani A, Aitken RJ, Baker MA, Ikawa M.
Title CRISPR/Cas9-Mediated Rapid Generation of Multiple Mouse Lines Identified Ccdc63 as Essential for Spermiogenesis.
Journal Int J Mol Sci.
Volume 16
Page 24732-50
Year 2015
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.