CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2613
Type of strain Targeted mutant.
Strain name B6.129S2-Mir200btm1.1Osb Mir429T30C
Internal Code miR-DKO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Mir429
Gene name microRNA 429
Allele symbol Mir429T31C
Allele name
MGI MGI:3619402,
Chromosome 4 (87.95) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM
Gene symbol Mir200b
Gene name microRNA 200b
Allele symbol Mir200btm1.1Osb
Allele name microRNA 200b, targeted mutation 1.1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:2676875,
Chromosome 4 (87.96) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
pr-3 GCACTTGACTGTCCTAATTCCCAGGGC
pr-4 GCCCATGGAATCTAGTCATCTTCAACTCCC


References

Author Hasuwa H, Ueda J, Ikawa M, Okabe M.
Title miR-200b and miR-429 function in mouse ovulation and are essential for female fertility.
Journal Science
Volume 341(6141)
Page 71-3
Year 2013
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.