CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2556
Type of strain Targeted mutant.
Strain name C57BL/6-Neurod6tm1(cre)
Internal Code NEX(Neurod6)-cre
Submitter Esumi Shigeyuki
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
If you use NEX(Neurod6)-Cre mouse, please contact to Prof. Klaus-Armin Nave in Max Planck Institute for MTA.
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Max Planck Institute for Experimental Medicine, Göttingen
Organization code
Developer Prof. Klaus-Armin Nave Ph.D.
Year introduced 2005 / 4
Introduced Generation 10
Remarks


Gene information

Gene symbol Neurod6
Gene name neurogenic differentiation 6
Allele symbol Neurod6tm1(cre)
Allele name neurogenic differentiation 6, targeted mutation 1,
MGI MGI:106593,
Chromosome 6 (27.53) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Cre F (e26) tcgatgcaacgagtgatgag
Cre R (e27) ttcggctatacgtaacaggg


References

Author Sandra Goebbels, Ingo Bormuth, Ulli Bode, Ola Hermanson, Markus H. Schwab, Klaus-Armin Nave
Title Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice
Journal GENESIS
Volume 44(12)
Page 611-21
Year 2006
PMID
Author Wu SX, Goebbels S, Nakamura K, Nakamura K, Kometani K, Minato N, Kaneko T, Nave KA, Tamamaki N.
Title Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone.
Journal Proc Natl Acad Sci U S A
Volume 102(47)
Page 17172-7
Year 2005
PMID


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Cell biology, Neurobiology, Hematology, Ophthalomology






Copyright @ 2021 Kumamoto University. All rights reserved.