CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2532
Type of strain Targeted mutant.
Strain name STOCK Tcte1em1(Tcte1-Flag)Osb
Internal Code Tcte1-FLAG KI
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tcte1
Gene name t-complex-associated testis expressed 1
Allele symbol Tcte1em1(Tcte1-Flag)Osb
Allele name t-complex-associated testis expressed 1; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:98640,
Chromosome 17 (22.54) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
F03 CTAGACCGACTATTCTCAGG
R01 TGTACAAGCAGACAACGTCAGG


References

Author Castaneda JM, Hua R, Miyata H, Oji A, Guo Y, Cheng Y, Zhou T, Guo X, Cui Y, Shen B, Wang Z, Hu Z, Zhou Z, Sha J, Prunskaite-Hyyrylainen R, Yu Z, Ramirez-Solis R, Ikawa M, Matzuk MM, Liu M
Title TCTE1 is a conserved component of the dynein regulatory complex and is required for motility and metabolism in mouse spermatozoa
Journal Proc Natl Acad Sci
Volume 114 (27)
Page 5370-5378
Year 2017
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.