CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2415
Type of strain Targeted mutant.
Strain name C57BL6N-Il1f6em1
Internal Code Il1f6-KO
Submitter Inaba Mutsumi
Submitter affiliation or code Graduate School of Veterinary Medicine, Hokkaido University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Hokkaido University
Organization code
Developer Osamu Ichii
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Il1f6
Gene name Interleukin 1 family member 6
Allele symbol Il1f6em1
Allele name Interleukin 1 family member 6, endonuclease-mediated mutation 1,
MGI MGI:1859324,
Chromosome 2 (16.26) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Other
OMIM

PCR Primer 1
F AGGTTAGAAACGCAGCCTGT
R TCTAAACTCACCCCAAGCTGTAG


Disease , Applicable field information

Disease name, Applicable field Unknown, Immunology, cancer






Copyright @ 2021 Kumamoto University. All rights reserved.