CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2385
Type of strain Targeted mutant.
Strain name BALB/c- Rag2tm1Jak3tm1Fahtm1
Internal Code BRJ-Fah
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Center for Animal Resource and Development, Kumamoto University
Organization code
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks Maintenance and rearing with water containing NTBC (7.5mg/L).


Gene information

Gene symbol Rag2
Gene name recombination activating gene 2
Allele symbol Rag2tm1
Allele name recombination activating gene 2, targeted mutation 1
MGI MGI:97849,
Chromosome 2 (53.87) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM
Gene symbol Jak3
Gene name Janus Kinase 3
Allele symbol Jak3tm1
Allele name Janus Kinase 3, targeted mutation 1
MGI MGI:99928,
Chromosome 8 (34.43) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM
Gene symbol Fah
Gene name fumarylacetoacetate hydrolase
Allele symbol Fah3tm1
Allele name fumarylacetoacetate hydrolase, targeted mutation 1
MGI MGI:95482,
Chromosome 7 (48.36) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Fah-Fw CTCTGCAGGAGACTACACGGACTTCTACTC
Fah-Re CCAATTTGGCAACAGCGCATTCTCCTTGCC


Disease , Applicable field information

Disease name, Applicable field Laboratory-animal Science, cancer, Urology, Digestive Disorders






Copyright @ 2021 Kumamoto University. All rights reserved.