CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2377
Type of strain Targeted mutant.
Strain name C57BL/6-Dnm1tm1
Internal Code Dnm1flox
Submitter Yamamura Ken-ichi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Insstitute of Resource Development and Analysis
Organization code
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Dnm1
Gene name dynamin 1
Allele symbol Dnm1tm1
Allele name dynamin 1, targeted mutation 1,
MGI MGI:107384,
Chromosome 2 (22.09) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection CRISPR/Cas9
OMIM

PCR Primer 1
Dnm1_intron1_F2 GGGCCTGCAGGGATGCATTTGCCTGGTACCTAGAAC
Dnm1_intron1_R2 GGGGGGAATTCCTATACCCAACATTGGCTCCTGCTG
Dnm1_intron4_F2 GGGGGATCCGCGCAGCAGGGGTCTAGTTTTAG
Dnm1_intron4_R2 GGGGGGAATTCCCCAGCCGGGTAAAAATGTTTCTTTGG


Disease , Applicable field information

Disease name, Applicable field Genetics, Immunology






Copyright @ 2021 Kumamoto University. All rights reserved.