CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2370
Type of strain Targeted mutant.
Strain name C57BL/6-Rbp4tm1(RBP4)Card
Internal Code mRbp4hRBP4mg
Submitter Yamamura Ken-ichi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Rbp4
Gene name retinol binding protein 4, plasma
Allele symbol Rbp4tm1(RBP4)Card
Allele name retinol binding protein 4, plasma, targeted mutation 1,
MGI MGI:97879,
Chromosome 19 (32.75) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
GSPF1 CTCGGCTCCGTCGCTCCACG
GSPR1 CCAGAGCCCAGAGAACTGAG


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.