CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2338
Type of strain Targeted mutant.
Strain name B6;129-Gtsf1tm1Miya
Internal Code Gtsf1 KO
Submitter Miyazaki Jun-ichi
Submitter affiliation or code Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code Miya
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gtsf1
Gene name Gametocyte specific factor 1
Allele symbol Gtsf1tm1Miya
Allele name Gametocyte specific factor 1, targeted mutation 1,
MGI MGI:1921424,
Chromosome 15 (58.93) (15F3) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
110EX4A3 TGTTTGTTTGTTTTCATGACAGGGTTTC
Puro-S4 ACCCGCAAGCCCGGTGCCTGA
110INT3S3 GGGGCACTGTAATAACTTTTCAGGGTCC


References

Author Yoshimura T, Miyazaki T, Toyoda S, Miyazaki S, Tashiro F, Yamato E, Miyazaki J
Title Gene expression pattern of Cue110: A member of the uncharacterized UPF0224 gene family preferentially expressed in germ cells
Journal Gene Expression Patterns
Volume 8
Page 27-35
Year 2007
PMID
Author Yoshimura T, Toyoda S, Kuramochi-Miyagawa S, Miyazaki T, Miyazaki S, Tashiro F, Yamato E, Nakano T, Miyazaki J
Title Gtsf1/Cue110, a gene encoding a protein with two copies of a CHHC Zn-finger motif, is involved in spermatogenesis and retrotransposon suppression in murine testes
Journal Developmental Biology
Volume 335
Page 216-227
Year 2009
PMID


Disease , Applicable field information

Disease name, Applicable field Development, Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.