CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2300
Type of strain Targeted mutant.
Strain name B6;B6CBF1-Ghtm1165-WT30
Internal Code 165-WT30
Submitter Araki Kimi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gh
Gene name growth hormone
Allele symbol Gh tm1
Allele name growth hormone, targeted mutation 1
MGI MGI:95707,
Chromosome 11 (68.89) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
GH1-5arm-f7 AGTCCAGATTCCAAACTGCT
GH1-3arm-r2 AAGAAGGGTGGTCACTGAGG
GH1-IVS3mut-gtrv GGGAGAAGGCATCCACTCAT


Disease , Applicable field information

Disease name, Applicable field Endocrine Disorders






Copyright @ 2021 Kumamoto University. All rights reserved.