CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2276
Type of strain Targeted mutant.
Strain name Balb/c-Hr,Rag-2tm1,Jak3tm1
Internal Code Balb/c-R/J mice
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Center for AIDS Research, Kumamoto University
Organization code 不明
Developer Seiji Okada
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Jak3
Gene name Janus kinase 3
Allele symbol Jak3,sup>tm1
Allele name Janus kinase 3, targeted mutation 1,
MGI MGI:99928,
Chromosome 8 (34.43) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM
Gene symbol Rag2
Gene name recombination activating gene 2
Allele symbol Rag2tm1
Allele name recombination activating gene 2, targeted mutation 1,
MGI MGI:97849,
Chromosome 2 (53.87) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
am05 (viral LTR) GCGTTACTGCAGCTAGCTTG
am06 (Hr exon 6) TGTAGCCTGTGGTCGCATAG
am07 (Hr intron 6) CTCCTGTTTGCTTGGTCATC
PCR Primer 2
Neo-3 CCAACGCTATGTCCTGATAGCGGT
RG2-2 TTAATTCAACCAGGCTTCTCACTT
RG2—3 GCCTGCTTATTGTCTCCTGGTATG
PCR Primer 3
Oligo1 CCA GAC CAG CAG AGG GAC TT
Oligo2 GAA CCT GCG TGC AAT CCA TCT TG
Oligo3 ACC CAG GTA CTC CAT GCC CT


Disease , Applicable field information

Disease name, Applicable field Physiology, Anatomy, Development, Immunology, cancer, Dermatology






Copyright @ 2021 Kumamoto University. All rights reserved.