CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2225
Type of strain Targeted mutant.
Strain name C57BL/6-Gpd2em3kymm
Internal Code Gpd2 KI,B6-Gpd2em-ins(loxP) ky
Submitter Ken-ichi YAMAMURA
Submitter affiliation or code Center for Animal Resources and Development Kumamoto University
Stock Type
Material Transfer Conditions No condition
Production method in-house breeding
Origin (In-house) Organization Center for Animal Resources and Development
Organization code
Developer Ken-ichi Yamamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gpd2
Gene name glycerol phosphate dehydrogenase 2, mitochondrial
Allele symbol
Allele name
MGI MGI:99778,
Chromosome 2 (31.66) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
1024 KO-F ACTGGCTACAGGAAAACCTC
lox71R ATGTATGCTATACGAACGGTA


Disease , Applicable field information

Disease name, Applicable field Metabolism






Copyright @ 2021 Kumamoto University. All rights reserved.