CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2213
Type of strain Targeted mutant.
Strain name STOCK-Svs2tm1Osb
Internal Code SVS2KO handai
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Joint research
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Institute for microbial diseases, Osaka University
Organization code
Developer Masaru Okabe
Year introduced
Introduced Generation F0
Remarks


Gene information

Gene symbol Svs2
Gene name seminal vesicle secretory protein 2
Allele symbol Svs2tm1Osb
Allele name seminal vesicle secretory protein 2, targeted mutation 1
MGI MGI:1858275,
Chromosome 2 (84.82) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
GO Gene Ontology
OMIM OMIM ID: 143030 Human Gene Symbol: CD9,

PCR Primer 1
2516 5'(caaacdtggggactaagcat)3'
Neo 5'(atctggacgaagagcatcag)3'


References

Author Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa
Title Seminal vesicle protein SVS2 is required for sperm survival in the uterus
Journal Proceedings of the National Academy of Sciences
Volume 111
Page 4145-4150
Year 2014
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.