CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2204
Type of strain Transgenic., Targeted mutant.
Strain name B6;129-Deddtm1TimyTg(Cdh5-Dedd)6Timy
Internal Code DEDD KO/ DEDD TG
Submitter Miyazaki Toru
Submitter affiliation or code Lab of Molecular Biomedicine for Pathogenesis, Center for Disease Biology and Integrative Medicine (CDBIM), The University of Tokyo
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Dedd
Gene name Death effector domain-containing (with C-terminal HA-tag)
Allele symbol Tg(Cdh5-Dedd)
Allele name transgene insertion
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM
Gene symbol Dedd
Gene name death effector domain-containing
Allele symbol Deddtm1Timy
Allele name death effector domain-containing, targeted mutation 1, Toru Miyazaki
MGI MGI:1333874,
Chromosome 1 (79.34) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
beta-globin 5 tgctggttattgtgctgtctcatc
Dedd215-191 tccagtgccaataagaagtcacgtc
PCR Primer 2
TM-1 cagccagatttacatagtgaaatc
NY-5 ccgctatcaggacatagcgttggc
PCR Primer 3
DEDD Exon2 gcactctatttctgagcctctagc
DEDD Intron2-3 atctttcttctcccaaaggatctc


References

Author Mori M, Kitazume M, Ose R, Kurokawa J, Koga K, Osuga Y, Arai S, Miyazaki T
Title Death effector domain-containing protein (DEDD) is required for uterine decidualization during early pregnancy in mice.
Journal J Clin Invest
Volume 121
Page 318-27
Year 2011
PMID


Disease , Applicable field information

Disease name, Applicable field Reproduction






Copyright @ 2021 Kumamoto University. All rights reserved.