CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2165
Type of strain Targeted mutant.
Strain name STOCK Lypd4tm1Osb/6A
Internal Code Lypd4 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Lypd4
Gene name Ly6/Plaur domain containing 4
Allele symbol Lypd4tm1Osb
Allele name Ly6/Plaur domain containing 4, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:2687054,
Chromosome 7 (13.30) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
#719 GCCTTCTATCGCCTTCTTGACGAGTTCTTC
#6156 CTAGGGATTACTGGCAAGAACGGGG
PCR Primer 2
#6157 GGGTTGACTGGCCTTGAGTCTCAC


References

Author Yoshitaka Fujihara, Taichi Noda, Kiyonori Kobayashi, Asami Oji, Sumire Kobayashi, Takafumi Matsumura, Tamara Larasati, Seiya Oura, Kanako Kojima-Kita, Zhifeng Yu, Martin M. Matzuk, and Masahito Ikawa
Title Identification of multiple male reproductive tract-specific proteins that regulate sperm migration through the oviduct in mice
Journal Proc Natl Acad Sci U S A.
Volume 116(37)
Page 18498-18506
Year 2019
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.