CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2148
Type of strain Targeted mutant.
Strain name STOCK Pdilttm1Osb/70
Internal Code Pdilt KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Pdilt
Gene name protein disulfide isomerase-like, testis expressed
Allele symbol Pdilttm1Osb
Allele name protein disulfide isomerase-like, testis expressed, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University
MGI MGI:1919080,
Chromosome 7 (63.90) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
4484 atggaactgctttggacacc
4485 aatactcacggaaaatcacc
PCR Primer 2
114 ATCTggACgA AgAgCATCAg


References

Author Tokuhiro K, Ikawa M, Benham AM, Okabe M.
Title Protein disulfide isomerase homolog PDILT is required for quality control of sperm membrane protein ADAM3 and male fertility [corrected].
Journal Proc Natl Acad Sci U S A
Volume 109(10)
Page 5905
Year 2012
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.