CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2132
Type of strain Transgenic., Targeted mutant.
Strain name B6D2-Pmis2tm1Osb Tg(Clgn-Spot3Myc)54Osb
Internal Code Pmis2-Myc TG
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Pmis2
Gene name Pmis2, sperm specific protein
Allele symbol Pmis2tm1Osb
Allele name Pmis2, sperm specific protein; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1922177,
Chromosome 7 (19.08) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM
Gene symbol Spot3
Gene name Spot3
Allele symbol
Allele name
MGI
Chromosome
Gene classification Gene to express(transgenic)
Method
OMIM

PCR Primer 1
196 CCTTCCTgCggCTTgTTCTCT
1793 CGAATTCTCATAGGACTAGGACAAG


References

Author Yamaguchi R, Fujihara Y, Ikawa M, Okabe M.
Title Mice expressing aberrant sperm-specific protein PMIS2 produce normal-looking but fertilization-incompetent spermatozoa
Journal Mol Biol Cell.
Volume 23(14)
Page 2671-9
Year 2012
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.