CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2114
Type of strain Targeted mutant.
Strain name C57BL/6-Gsh2,sup>tm1(Flpe)
Internal Code Gsh2-Flpe knock-in Mouse
Submitter Esumi Shigeyuki
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Others
If you use Gsh2-Flpe mouse, please contact Dr. Tsutomu Hirata for MTA.
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer Dr. Tsutomu Hirata
Year introduced 2014 / 3
Introduced Generation 3
Remarks


Gene information

Gene symbol Gsh2
Gene name GS homeobox 2
Allele symbol Gsh2,sup>tm1(Flpe)
Allele name GS homeobox 2, targeted mutation 1,
MGI MGI:95843,
Chromosome 5 (39.55) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Flpe F CACTGATATTGTAAGTAGTTTGC
Flpe R CTAGTGCGAAGTAGTGATCAGG


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Development, Laboratory-animal Science, Cell biology, Neurobiology, Ophthalomology






Copyright @ 2021 Kumamoto University. All rights reserved.