CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2107
Type of strain Targeted mutant.
Strain name C57BL/6N-Gt(ROSA)26Sortm1(lox71-neo-loxP)Kymm
Internal Code C57BL/6N-Gt(ROSA)26Sortm1(lox71-neo-loxP)Ky
Submitter Yamamura Ken-ichi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions No condition
Production method in-house breeding
Origin (In-house) Organization
Organization code CARD
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gt(ROSA)26Sor
Gene name gene trap ROSA 26, Philippe Soriano
Allele symbol
Allele name
MGI MGI:104735,
Chromosome 6 (52.73) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
rosa_F2772 ATCCTAAGGTCACTTTTAAATTGAGG
neo_MS ATTCGCAGCGCATCGCCTTCTATCGCCTTC


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.