CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2067
Type of strain Targeted mutant.
Strain name MSM/Ms-Hnf4atm1Card
Internal Code MSM/Ms-Hnf4a(1a)tm1Card
Submitter Yamamura Ken-ichi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code Card
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hnf4a
Gene name hepatic nuclear factor 4, alpha
Allele symbol Hnf4atm1Card
Allele name hepatic nuclear factor 4, alpha, targeted mutation 1, Naomi Nakagata
MGI MGI:109128,
Chromosome 2 (84.32) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
sc_5AF3 TTTGGCGCGCCTAGACAATGAGTCCCTTTTCACTCC
neo_108r CCTCAGAAGAACTCGTCAAGAAG


Disease , Applicable field information

Disease name, Applicable field Diabetes






Copyright @ 2021 Kumamoto University. All rights reserved.