| CARD ID | 1829 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Nenftm1Kyo | |
| Internal Code | Neudesin knock out mouse | |
| Submitter | Nobuyuki Itoh | |
| Submitter affiliation or code | Department of Genetic Biochemistry, Kyoto University Graduate School of Pharmaceutical Sciences | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | 不明 | |
| Developer | ||
| Year introduced | 2009 | |
| Introduced Generation | F1 | |
| Remarks | ||
| Gene symbol | Nenf |
| Gene name | neuron derived neurotrophic factor |
| Allele symbol | Nenftm1 |
| Allele name | targeted mutation 1 |
| MGI | MGI:1913458, |
| Chromosome | 1 (96.28) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| genotype-Neos | agcgaaggagcaaagctgctattg |
| genotype-Neua | ggccatcctggtctacctagaaat |
| Disease name, Applicable field | Metabolism |