CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1790
Type of strain Targeted mutant.
Strain name Alk2-flox
Internal Code Alk2-flox mouse
Submitter Esumi Shigeyuki
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
You need MTA with Michigan Univ.
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization University of Michigan
Organization code
Developer Vesa Kaartinen
Year introduced 2011 / 4
Introduced Generation
Remarks Need MTA with University of Michigan


Gene information

Gene symbol Acvr1 (synonymous to Alk2)
Gene name Activin receptor type 1
Allele symbol Alk2tm1
Allele name Activin receptor type 1; targeted mutation 1
MGI
Chromosome 2 (33.05) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Alk2I7F (Alk2-Intron7-Forward) CCCCCATTGAAGGTTTAGAGAGAC
Alk2I7R2 (Alk2-Intron7-Reverse2) CTAAGAGCCATGACAGAGGTTG


Disease , Applicable field information

Disease name, Applicable field Development, Urology, Neurobiology, Digestive Disorders, Hematology, Osteosis






Copyright @ 2021 Kumamoto University. All rights reserved.