CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1059
Type of strain Targeted mutant.
Strain name B6;129-Gtrgeo22tm1(Rosa26 Stop Sall1)32Imeg
Internal Code Rosa26 Stop Sall1 #32
Submitter Nishinakamura Ryuichi
Submitter affiliation or code Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Molecular Embryology and Genetics, Kumamoto University
Organization code Imeg
Developer Ryuichi Nishinakamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Gtrgeo22
Gene name gene trap ROSA b-geo 22
Allele symbol Gtrgeo22tm1(Rosa26 Stop Sall1)32Imeg
Allele name targeted mutation 1, Institute of Molecular Embryology and Genetics
MGI
Chromosome 10 (43.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Neo Forward: AAGGGACTGGCTGCTATTGG, Reverse: ATATCACGGGTAGCCAACGC
Rosa26 wild type Forward: GAGTTCTCTGCTGCCTCCTG, Reverse: CCGACAAAACCGAAAATCTG


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.