CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 1058
Type of strain Targeted mutant.
Strain name B6;129-Gtrgeo22tm1(Rosa26 Stop NICD2)99Imeg
Internal Code Rosa26 Stop NICD2 #99
Submitter Nishinakamura Ryuichi
Submitter affiliation or code Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Institute of Molecular Embryology and Genetics, Kumamoto University
Organization code Imeg
Developer Ryuichi Nishinakamura
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks NICD2: intracellular domain of Notch2


Gene information

Gene symbol Gtrgeo22
Gene name gene trap ROSA b-geo 22
Allele symbol Gtrgeo22tm1(Rosa26 Stop NICD2)99Imeg
Allele name targeted mutation 1, Institute of Molecular Embryology and Genetics
MGI
Chromosome 10 (43.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Neo Forward:AAGGGACTGGCTGCTATTGG, Reverse: ATATCACGGGTAGCCAACGC
Rosa wild-type Forward: GAGTTCTCTGCTGCCTCCTG, Reverse: CCGACAAAACCGAAAATCTG


References

Author Fujimura S, Jiang Q, Kobayashi C, and Nishinakamura R
Title Notch2 activation in the embryonic kidney depletes nephron progenitors
Journal J. Am. Soc. Nephrol
Volume 21(5)
Page 803-810
Year 2010
PMID


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.