| CARD ID | 1736 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;Cg-Atg5tm1Myok Spink3tm1(cre)Imeg | |
| Internal Code | Atg5 flox/-;Spink3-cre mouse | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | Institute of Resource Development and Analysis, Kumamoto university |
| Organization code | Card | |
| Developer | Ken-ichi Yamamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spink3 |
| Gene name | serine peptidase inhibitor, Kazal type 3 |
| Allele symbol | Spink3tm1(cre)Imeg |
| Allele name | serine peptidase inhibitor, Kazal type 3; targeted mutation 1, Institute of Molecular Embryology and Genetics |
| MGI | |
| Chromosome | 18 (23.47) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Atg5 |
| Gene name | autophagy-related 5 |
| Allele symbol | Atg5tm1Myok |
| Allele name | autophagy-related 5; targeted mutation 1, Minesuke Yokoyama |
| MGI | |
| Chromosome | 10 (23.24) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| check2 | acaacgtcgagcacagctgcgcaagg |
| short2 | gtactgcataatggtttaactcttgc |
| exon3-1 | gaatatgaaggcacacccctgaaatg |
| Author | Hara T, Nakamura K, Matsui M, Yamamoto A, Nakahara Y, Suzuki-Migishima R, Yokoyama M, Mishima K, Saito I, Okano H, Mizushima N |
| Title | Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. |
| Journal | Nature |
| Volume | 441 |
| Page | 885-9 |
| Year | 2006 |
| PMID |
| Author | Hashimoto D, Ohmuraya M, Hirota M, Yamamoto A, Suyama K, Ida S, Okumura Y, Takahashi E, Kido H, Araki K, Baba H, Mizushima N, Yamamura K. |
| Title | Involvement of autophagy in trypsinogen activation within the pancreatic acinar cells. |
| Journal | J Cell Biol. |
| Volume | 181 |
| Page | 1065-72 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Digestive Disorders |