| CARD ID | 2204 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | B6;129-Deddtm1TimyTg(Cdh5-Dedd)6Timy | |
| Internal Code | DEDD KO/ DEDD TG | |
| Submitter | Miyazaki Toru | |
| Submitter affiliation or code | Lab of Molecular Biomedicine for Pathogenesis, Center for Disease Biology and Integrative Medicine (CDBIM), The University of Tokyo | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Dedd |
| Gene name | Death effector domain-containing (with C-terminal HA-tag) |
| Allele symbol | Tg(Cdh5-Dedd) |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Gene symbol | Dedd |
| Gene name | death effector domain-containing |
| Allele symbol | Deddtm1Timy |
| Allele name | death effector domain-containing, targeted mutation 1, Toru Miyazaki |
| MGI | MGI:1333874, |
| Chromosome | 1 (79.34) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| beta-globin 5 | tgctggttattgtgctgtctcatc |
| Dedd215-191 | tccagtgccaataagaagtcacgtc |
| TM-1 | cagccagatttacatagtgaaatc |
| NY-5 | ccgctatcaggacatagcgttggc |
| DEDD Exon2 | gcactctatttctgagcctctagc |
| DEDD Intron2-3 | atctttcttctcccaaaggatctc |
| Author | Mori M, Kitazume M, Ose R, Kurokawa J, Koga K, Osuga Y, Arai S, Miyazaki T |
| Title | Death effector domain-containing protein (DEDD) is required for uterine decidualization during early pregnancy in mice. |
| Journal | J Clin Invest |
| Volume | 121 |
| Page | 318-27 |
| Year | 2011 |
| PMID |
| Disease name, Applicable field | Reproduction |