CARD ID | 3287 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Il1rl2em1(3XFlag) | |
Internal Code | Il1rl2-3xFlag | |
Submitter | Mitsuyoshi Takiguchi | |
Submitter affiliation or code | Faculty of Veterinary Medicine, Hokkaido University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Gunma University |
Organization code | ||
Developer | Izuho Hatada | |
Year introduced | 2021 / 9 | |
Introduced Generation | F0 | |
Remarks |
Gene symbol | Il1rl2 |
Gene name | interleukin 1 receptor-like 2 |
Allele symbol | Il1rl2em1(3XFlag) |
Allele name | interleukin 1 receptor-like 2; endonuclease-mediated mutation 1, |
MGI | MGI:1913107, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
mIl1rl2FLAG-F2 | GGACTTCACAGAGCAGTCACAG |
mIl1rl2FLAG-R2 | AGTGTGAGCCAACACACACTAAC |
Disease name, Applicable field |